Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

96 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

OpenSSF Best Practices License: PMPL-1.0 Project Topology Completion Status License image:Julia

A Julia package for phylogenetic analysis and cladistics — the study of evolutionary relationships among organisms.

Overview

Cladistics is a method of biological classification that groups organisms based on their evolutionary ancestry and shared derived characteristics (synapomorphies). This package provides computational tools for reconstructing and analyzing phylogenetic trees from molecular sequence data and morphological characters.

What is Cladistics?

  • Clade: A monophyletic group consisting of an ancestor and all its descendants

  • Synapomorphy: A shared derived characteristic that defines a clade

  • Phylogenetic Tree: A branching diagram showing evolutionary relationships

  • Parsimony: The principle that the simplest evolutionary explanation (fewest changes) is preferred

  • Bootstrap Analysis: Statistical method to assess confidence in tree topology

Features

Distance-Based Methods

  • Multiple Distance Metrics: Hamming, p-distance, Jukes-Cantor 1969, Kimura 2-parameter

  • UPGMA: Unweighted Pair Group Method with Arithmetic Mean (assumes molecular clock)

  • Neighbor-Joining: Does not assume molecular clock, handles rate variation

Character-Based Methods

  • Maximum Parsimony: Find trees requiring fewest evolutionary changes

  • Fitch Algorithm: Efficient parsimony score calculation

  • Parsimony-Informative Sites: Identify characters useful for phylogenetic inference

Tree Analysis

  • Bootstrap Support: Assess confidence in tree topology (1000+ replicates)

  • Clade Identification: Extract well-supported monophyletic groups

  • Robinson-Foulds Distance: Compare tree topologies quantitatively

  • Tree Rooting: Root unrooted trees using outgroup taxa

  • Newick Format: Export trees in standard phylogenetic format

Installation

using Pkg
Pkg.add("Cladistics")

Quick Start

using Cladistics
using Plots

# 1. DNA sequence data (aligned)
sequences = [
    "ATCGATCGATCG",  # Species A
    "ATCGATCGATCG",  # Species B (same as A)
    "ATCGTTCGATCG",  # Species C
    "TTCGATCGATCG",  # Species D
    "TTCGTTCGATCC"   # Species E (outgroup)
]
taxa_names = ["Species_A", "Species_B", "Species_C", "Species_D", "Species_E"]

# 2. Calculate evolutionary distances
dmat = distance_matrix(sequences, method=:jc69)

# 3. Build phylogenetic tree using UPGMA
upgma_tree = upgma(dmat, taxa_names=taxa_names)
newick = tree_to_newick(upgma_tree)

# 4. Build tree using Neighbor-Joining
nj_tree = neighbor_joining(dmat, taxa_names=taxa_names)

# 5. Compare tree topologies
rf_distance = tree_distance(upgma_tree, nj_tree)

# 6. Bootstrap analysis for confidence
support = bootstrap_support(sequences, replicates=1000, method=:nj)

# 7. Identify well-supported clades
clades = identify_clades(upgma_tree, 0.95)

Distance Methods Comparison

using Cladistics
sequences = ["ATCG", "ATCG", "TTCG", "TTCC"]

hamming = distance_matrix(sequences, method=:hamming)   # Simple counting
p_dist  = distance_matrix(sequences, method=:p_distance) # Proportion of differences
jc69    = distance_matrix(sequences, method=:jc69)       # Jukes-Cantor
k2p     = distance_matrix(sequences, method=:k2p)        # Kimura 2-parameter

Tree Construction Methods

UPGMA: Simple but assumes molecular clock

dmat = [0.0 0.2 0.4; 0.2 0.0 0.3; 0.4 0.3 0.0]
tree = upgma(dmat, taxa_names=["Human", "Chimp", "Gorilla"])
# Good for: recent divergences, molecular clock valid
# Not good for: ancient divergences, variable rates

Neighbor-Joining: No molecular clock assumption

dmat = [0.0 0.5 0.8 1.0; 0.5 0.0 0.6 0.9; 0.8 0.6 0.0 0.4; 1.0 0.9 0.4 0.0]
tree = neighbor_joining(dmat, taxa_names=["A", "B", "C", "D"])
# Good for: variable evolutionary rates, large datasets

Bootstrap Analysis

using Cladistics, Random
Random.seed!(42)
sequences = [
    "ATCGATCGATCGATCG",
    "ATCGATCGATCGATCG",
    "ATCGTTCGATCGATCG",
    "TTCGATCGATCGATCG",
    "TTCGTTCGATCGTTCC"
]
# 1000 bootstrap replicates — resamples alignment columns with replacement
support = bootstrap_support(sequences, replicates=1000, method=:nj)
# Interpret: >95% Strong, 70-95% Moderate, <70% Weak

Maximum Parsimony

using Cladistics
alignment = ["ATCG", "ATCG", "TTCG", "TTCC"]
char_matrix = character_state_matrix(alignment)
informative_sites = parsimony_informative_sites(char_matrix)
dmat = distance_matrix(alignment, method=:hamming)
tree = upgma(dmat, taxa_names=["Tax1", "Tax2", "Tax3", "Tax4"])
score = calculate_parsimony_score(tree, char_matrix)
# Lower score = more parsimonious (preferred)

Real-World Example: Primate Phylogeny

using Cladistics
primate_sequences = [
    "ATCGATCGATCGATCGATCG",  # Human
    "ATCGATCGATCGATCGATCG",  # Chimp
    "ATCGATCGTTCGATCGATCG",  # Gorilla
    "ATCGTTCGTTCGATCGTTCG",  # Orangutan
    "TTCGTTCGTTCGTTCGTTCG"   # Lemur (outgroup)
]
taxa = ["Human", "Chimp", "Gorilla", "Orangutan", "Lemur"]
dmat = distance_matrix(primate_sequences, method=:k2p)
tree = neighbor_joining(dmat, taxa_names=taxa)
rooted_tree = root_tree(tree, "Lemur")
support = bootstrap_support(primate_sequences, replicates=100, method=:nj)
newick = tree_to_newick(rooted_tree)

Key Concepts

Molecular Clock

  • Assumption: constant evolutionary rate across lineages

  • When valid: recent species, similar generation times

  • Methods: UPGMA assumes molecular clock

  • When violated: use Neighbor-Joining

Bootstrap Support Interpretation

  • >95%: Publish with confidence

  • 70–95%: Mention uncertainty

  • <70%: Weak support, collect more data

Parsimony vs Distance

  • Parsimony: Find tree requiring fewest character changes; NP-hard but theoretically clear

  • Distance: Fast, scales to large datasets; loses some information from pairwise comparisons

References

Classic Papers

  • Felsenstein, J. (1985). "Confidence limits on phylogenies: An approach using the bootstrap." Evolution, 39(4), 783–791.

  • Saitou, N., & Nei, M. (1987). "The neighbor-joining method." Molecular Biology and Evolution, 4(4), 406–425.

  • Fitch, W. M. (1971). "Toward defining the course of evolution." Systematic Zoology, 20(4), 406–416.

Textbooks

  • Felsenstein, J. (2004). Inferring Phylogenies. Sinauer Associates.

  • Lemey, P. et al. (2009). The Phylogenetic Handbook. Cambridge University Press.

  • Hall, B. G. (2011). Phylogenetic Trees Made Easy. Sinauer Associates.

Evolutionary Models

  • Jukes, T. H., & Cantor, C. R. (1969). "Evolution of protein molecules." Mammalian Protein Metabolism, pp. 21–132.

  • Kimura, M. (1980). "A simple method for estimating evolutionary rates." Journal of Molecular Evolution, 16(2), 111–120.

Citation

@software{cladistics_jl,
  author = {Jewell, Jonathan D.A.},
  title = {Cladistics.jl: Phylogenetic Analysis in Julia},
  year = {2026},
  url = {https://github.com/hyperpolymath/Cladistics.jl}
}

Related Projects

  • BioJulia — Broader bioinformatics ecosystem

  • PhyloNetworks — Phylogenetic networks

  • Phylo — Alternative phylogenetics package

External Visualization Tools

Contributing

See CONTRIBUTING for guidelines.

Wondering how this works? See EXPLAINME.adoc.

License

SPDX-License-Identifier: CC-BY-SA-4.0
See LICENSE.

Releases

Packages

Used by

Contributors

Languages