Skip to content

SowpatiLab/ribbit

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

135 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

ribbit-logo

Important

Ribbit is under active development. Please refer to Change log and make sure to get the latest version of the repository.

ribbit

Ribbit identifies tandem repeat (TR) regions of variable motif sizes in DNA sequences. Tandem repeats are DNA segments consisting of two or more nearly identical copies of a motif occurring contiguously. Ribbit is designed to improve motif decomposition and resolve complex repeat structures, accurately detecting TRs with motif sizes up to 100 bp.

The algorithm converts DNA sequences to 2-bit format and uses basic bit operations to deliniate potential repetitive stretches of a certain periodicity. The DNA sequence of a potential repetitive stretch is decomposed to identify a representative motif of identified peridicity. There are two different approaches to identifying the representative motif depending the on the peridicity. The sequence in the potential stretch is aligned with the perfect repeat of the identified representative motif to calculate the purity of the repeat. The potential sequence is either trimmed or dropped based on the user desired purity and minimum repeat length thresholds. A given sequence is idependently processed for potential repeats of all user-desired motif sizes. The results from each idependent search are merged and compared to resolve for nested/overlapping interpretations of a sequence as repetitive sequence of different periodicities. Overlapping tandem repeat interpretations of different motif sizes are retained/dropped based on preference for more pure stretches.

The conversion of DNA to 2-bit stretches results in fast identification of potential repetitive stretches and allows the time for careful motif decomposition of repeat sequence. Ribbit provides a comprehensive bed file as an output and takes about 5-7 secs to resolve an MB of DNA sequence. The program can also be run on multi-threaded mode making it ideal for processing large genomes.

Table of Contents

  1. Compiling
  2. Usage
  3. Options description
  4. Output
  5. Citation
  6. Change log
  7. Authors
  8. Contact

Compiling

To compile Ribbit, please follow these instructions:

1. Installing dependencies

sudo apt-get install boost
sudo apt-get install zlib1g-dev

2. Instruction for compiling

git clone https://github.com/SowpatiLab/ribbit.git
git checkout dev
cd ribbit
make

Usage

Here are some basic usage examples:

$ ./ribbit [options] -i sequence.fasta 

# with output file provided
$ ./ribbit [options] -i sequence.fasta -o results.bed

# pip input from standard input
$ cat sequence.fasta | ./ribbit [options] -i - 
$ echo "ATgcatgcGGAGGAGGAGGAGGAGGAcagtcgata" | ./ribbit -i - 

To view detailed help information

./ribbit -h

Ribbit: identification of tandem repeats and annotation of complex TRs in genomes
Version: 1.0.2

Options for running the tool:
  -h [ --help ]                 Ribbit detects tandem repeat regions in DNA, accurately resolving 
                                complex repeat structures and motif sizes up to 100 bp.
  --version                     Prints out the version of ribbit.
  -i [ --input-file ] arg       Input sequence. Can be a fasta file (optionally gzipped) or '-' for
                                stdin.
  -o [ --output-file ] arg      File path for output file. Default: stdout
  -m [ --min-motif-length ] arg The minimum length of the motif of the TR loci. [int] Default: 2
  -M [ --max-motif-length ] arg The maximum length of the motif of the TR loci. [int] Default: 100
  -p [ --min-purity ] arg       The minimum allowed purity of repeat sequence. Purity is calculated
                                as the (matches/(matches+mismatches+indels)) in the alignment of 
                                region sequence to perfect repeat of consensus motif. [float] 
                                Default: 0.8
  -q [ --min-motif-purity ] arg Minimum purity of each motif with consensus motif. Calculated as 
                                the average of (matches/(matches+mismatches+indels)) for each motif
                                length in the alignment of region sequence to perfect repeat of 
                                consensus motif. [float] Default: 0.8
  -l [ --min-length ] arg       The minimum length of the repeat. Input can be an integer or a 
                                tab-separated file with two columns of motif length and the length 
                                cutoff. [int or file] Default: 12 for STRs (motif length <= 6), 
                                2*(motif length) for others.
  --min-units arg               The minimum number of units of the repeat. Input can be a integer 
                                or a tab-separated file with two columns, first is the motif size 
                                and second unit cutoff. [int or file] Default: 2 for all motif 
                                sizes.
  --perfect-units arg           The minimum number of complete units with 100% match with the 
                                consensus motif in the repeat. Input can be an integer or a 
                                tab-separated file with two columns of the motif length and the 
                                unit cutoff. [int or file] Default: 2
  --cigar                       Include cigar string of the alignment of the sequence with the 
                                perfect repeat of the consensus motif in the output. Default: 
                                false.
  -t [ --threads ] arg          Number of threads to be used for running. [int] Default: 1

Options description

1. Repeat purity -p or --min-purity

After identifying a potential repetitive region with a given periodicity, Ribbit determines the consensus motif of the tandem repeat. The sequence is then aligned to a perfect tandem repeat generated from this consensus motif. Repeat purity is calculated as the number of matching bases divided by the alignment length between the sequence and the perfect repeat. The --min-purity option allows users to set the minimum purity threshold for tandem repeat detection. It accepts a floating-point value between 0 and 1.


$purity = matches / (matches + mismatches + indels)$

2. Motif purity -q or --min-motif-purity

Motif purity is purity calculated for each motif stretch and is then averaged across all the motifs. --min-motif-purity option allows users to set the minimum threshold for a TR. This is used to trim the motifs of lesser purity from the edges of the repeat and report the stretch with average motif purity greater than or equal to the user defined threshold. It accepts a floating-point value between 0 and 1.

motif purity at the ith motif is calculated as


$motif\_purity_i = matches / ((matches + mismatches + indels))$

motif purity is calculated as the average across all motif units


$motif\_purity = average(motif\_purity_0 + motif\_purity_1 +... + motif\_purity_n)$

Output

Output columns

S.No Column Description
1 Chromosome chromosome or sequence name as specified in fasta header
2 Repeat Start 0-based start position of tandem repeat in the chromosome
3 Repeat Stop end position of tandem repeat in the chromosome
4 Motif sequence of unit motif of tandem repeat
5 Purity purity of the repeat
6 Motif length length of the unit motif in bases
7 Repeat Length length of the repeat based on the coordinates
8 Repeat Units number of unit motifs of the TR
9 Info additional information of the repeat region including the CIGAR string of alignment and information of the nested TRs in the region.

Output file example

chromosome start end motif purity motif_length repeat_length repeat_units info
test 292 305 AC 0.93 2 13 6 I
test 481 496 AGC 0.82 3 15 5 I
test 827 843 GCCCAGGT 1.00 8 16 2 I
test 1017 1032 TGCGGAG 0.93 7 15 2 I
test 1508 1523 AGGC 0.81 4 15 3 I
test 1682 1833 TGGAGGGTGGGGCCAAATGGAAGTGGGCGGGGCTGTGG 0.90 38 151 3 I
test 1863 1890 AGGGC 0.83 5 27 5 M:1869-1890-6-0.81:AGGGGC
test 2182 2197 CCGGT 0.93 5 15 3 I
test 2277 2296 TGGCCTCC 1.00 8 19 2 I

INFO Field Description

The INFO field provides detailed information about tandem repeat (TR) structure, purity, and nested sub-repeats.
Each attribute in the field is separated by a colon (:).

Format:

<M_or_I> : <subrepeat_info> : <motifs>

if the --cigar option is enabled:

<M_or_I> : <CIGAR> : <subrepeat_info> : <motifs> : <subrepeat_CIGARs>

Attribute Description:

Attribute Description
Type Indicates whether the repeat is isolated (I) or contains nested, more pure repeats (M).
CIGAR (optional) If the --cigar option is enables this reports the CIGAR string of the alignment of sequence with a perfect repeat of the consensus motif.
2nd – Subrepeat info Lists subrepeats in the format {start}-{stop}-{period}-{purity}, separated by commas.
Example: 1068-1115-6-1.00 means a subrepeat from position 1068–1115, with motif length 6 bp and 100% purity.
3rd – Motifs Provides the motifs of the corresponding subrepeats, separated by commas.
Subrepeat CIGAR strings (optional) If the --cigar option is used, lists the CIGAR strings of each subrepeat, separated by commas.

Example:

M:1068-1115-6-1.00,1103-1126-11-1.00,1114-1126-6-1.00:AACCCT,accctaaccct

#with --cigar enabled
M100M:1068-1115-6-1.00,1103-1126-11-1.00:AACCCT,accctaaccct:47M,23M

Citation

If you found ribbit useful, we would appreciate it if you could cite our manuscript: Ribbit: Accurate identification and annotation of complex tandem repeat sequences in genomes

Change log

version 1.0.3 - 11-04-2025

  • Removed bug to exclude N at the end of the repeat.

version 1.0.2 - 28-10-2025

  • Optimized alignment for seeds larger than 10kb.

version 1.0.1 - 23-10-2025

  • Fixed concatenating outputs in multi-threaded mode.
  • Taking sequence input from standard input.
  • Default output directed to standard output.
  • Fixed seed sorting for seed with identical coordinates.

version 1.0.0 - 20-10-2025

  • Ribbit underwent major changes in this version. The algorithmic logic for identifying the potential tandem repeats (seed TRs) has changed.
  • The output format has been changed. TR regions are reported with the nested nested repeats reported in the info column.

Authors

Anukrati Sharma
Akshay Kumar Avvaru

Contact

For queries or suggestions, please contact:
Akshay Kumar Avvaru - avvaruakshay@gmail.com
Divya Tej Sowpati - tej@ccmb.res.in

About

Ribbit is a tool to identify tandem repeats in genome sequences.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors